View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8463_high_9 (Length: 404)
Name: NF8463_high_9
Description: NF8463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8463_high_9 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 160 - 404
Target Start/End: Complemental strand, 10865653 - 10865409
Alignment:
| Q |
160 |
tcttttctcattttgttcaagagatttgattcatgtgagtttcgaatgctcaaaagtgttgtgttggattttaggggctcaagctagagaattgacaagg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10865653 |
tcttttctcattttgttcaagagatttgattcatgtgagtttcgaatgctcaaaagtgttgtgttggattttaggggctcaagctagaggattgacaagg |
10865554 |
T |
 |
| Q |
260 |
aataaggctgtggttaatctaggtaaggttgagtggttgatcaaaatgagttattattgctaaaattgattgtgcttgagctttatggaatttgaataga |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10865553 |
aataaggctgtggttaatctaggtaaggttgagtggttgctcaaaatgagttattattgctaaaagtgattgtgcttgagctttatggaatttgaataga |
10865454 |
T |
 |
| Q |
360 |
aatttgtatgacagtacaggtgataatcggattactgctatttct |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10865453 |
aatttgtatgacagtacaggtgataatcggattactgctatttct |
10865409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 10865842 - 10865697
Alignment:
| Q |
19 |
tcattcccattcatttcctttccttcacttctgttagcatgagaggaaggcaaggcatgggttttggagcttaatcttgaggatgcatgttgttgagtaa |
118 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10865842 |
tcattccaattcattttctttccttcacttctgttagcatgagaggaaggcaaggcatgggttttggagcttaatcttgaggatgcatgttgttgagtaa |
10865743 |
T |
 |
| Q |
119 |
caagaagttaaggtaagctaataaattcattatcatccctttcttt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10865742 |
caagaagttaaggtaagctaataaattcattatcatccctttcttt |
10865697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University