View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8463_low_8 (Length: 502)
Name: NF8463_low_8
Description: NF8463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8463_low_8 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 448; Significance: 0; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 448; E-Value: 0
Query Start/End: Original strand, 13 - 468
Target Start/End: Original strand, 217768 - 218223
Alignment:
| Q |
13 |
attattctatcactttttaatttctgaatctctttctcattatcttttccctctgaacttctaagctttttctcagccttcaatccttcattcaataaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
217768 |
attattctatcactttttaatttctgaatctctttctcattatcttttccctctgaacttctaagctttttctcagccttcaatccttcattcaataaaa |
217867 |
T |
 |
| Q |
113 |
tgaaatcagctataatgaagaaaacatatcccacagcctcaccaaaagctgatatgaaactcatcttctttgccaagtttgcatccacagttccaattct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
217868 |
tgaaatcagctataatgaagaaaacatatcccacagcctcaccaaaagctgatatgaaactcatcttctttgccaagtttgcatccacagttccaattct |
217967 |
T |
 |
| Q |
213 |
tgataaccaaagaaaatggtcaaagaagaaatagaccatttctcctgaattagaaagcactgctagtaaccttaaagtgagagtagaaccaggatttctt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
217968 |
tgataaccaaagaaaatggtcaaagaagaaatagaccatttctcctgaattagaaagcactgctagtaaccttaaagtgagagtagaaccaggatttctt |
218067 |
T |
 |
| Q |
313 |
ctaagaccattgaatccagtgagaaaccttccagttctgaatgcttttctgctgagaccagaagctacttcccaatttttgaacctcttggatatatcag |
412 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
218068 |
ctaagagcattgaatccagtgagaaaccttccagttctgaatgcttttctgctgagaccagaagctacttcccaatttttgaacctcttggatatatcag |
218167 |
T |
 |
| Q |
413 |
ggtgagtgacttccacatgccagtttgcaagcttggaaacatattggaatgtcttc |
468 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
218168 |
ggtgagtgacttccacacgccagtttgcaagcttggaaacatattggaatgtcttc |
218223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University