View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8466_high_11 (Length: 332)
Name: NF8466_high_11
Description: NF8466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8466_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 14 - 265
Target Start/End: Complemental strand, 26711139 - 26710882
Alignment:
| Q |
14 |
attatactaactatcattatgtatcatttcaagaatgatattattcggctaaactcannnnnnnnnnnnnnn-----aatgtgtttaaaaccagtggcca |
108 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26711139 |
attatattaactaccattatgtatcatttcaagaatgatattattcggctaaactcatttttattttttatttttttaatgtgtttaaaaccagtggcca |
26711040 |
T |
|
| Q |
109 |
tggaagacttacttctagctactgatatagagatgccgacatggaaatagctttatatatttggttgattatgtatctcctttgttgattgttgttgtgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26711039 |
tggaagacttacttctagctactgatatagaggtgccgacatagaaatagctttatatatttggttgattatgtatctcctttgttgattgttgttgtgt |
26710940 |
T |
|
| Q |
209 |
attacactc-tttattcttcttaaatgtattatgctattggttttctttgcaaatttt |
265 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26710939 |
attacactcttttatacttcttaaatgtattatgctattggttttctttgcaaatttt |
26710882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University