View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8466_low_17 (Length: 246)
Name: NF8466_low_17
Description: NF8466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8466_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 26711356 - 26711117
Alignment:
| Q |
7 |
gatgaagggagaaaaattgcttgcaagagtccatgttataccactagagagccaaagcattgttgcactgaggaatatgcttcacctgaaaagtgtgcgg |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26711356 |
gatgaagggagaaagattgcttgcaagagtccatgttataccactagagagccaaagcattgttgcactgaggaatatgcttcacctgaaaagtgtgcgc |
26711257 |
T |
 |
| Q |
107 |
caaatcgatacacagagcttttagagaatcgatgtccaagtactgtttctaatgcttttgatgaaactcatttcacatgttttggtggaactagtttttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26711256 |
caaatcgatacacagagcttttagagaatcgatgtccaagtactgtctctaatgcttttgatgaaactcatttcacatgttttggtgggactagtttttt |
26711157 |
T |
 |
| Q |
207 |
aatattattcggctaaaattatattaactatcattatgta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26711156 |
aatattattcggctaaaattatattaactaccattatgta |
26711117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University