View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8467_high_4 (Length: 202)
Name: NF8467_high_4
Description: NF8467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8467_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 9e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 44357769 - 44357604
Alignment:
| Q |
18 |
agaaacttttctttaggtgaacttcaagaggtgagtgctcttaannnnnnnnnctccaacatgtttgttttcatttactgcaattcaaaatattcatagn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44357769 |
agaaacttttctttaggtgaacttcaagaggtgagtgctcttaatttttttt-ctccaacatgtttgttttcatttactgcaattcaaaatattcatagt |
44357671 |
T |
 |
| Q |
118 |
nnnnnnnnnnnnnnnnnnngagcagggttatgtttttgaagaagaaaatggaaaatgtgctgcattt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44357670 |
ttttttttcttttcattttgagcagggttatgtttttgaagaagaaaatggaaaatgtgctgcattt |
44357604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University