View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8468_high_5 (Length: 255)
Name: NF8468_high_5
Description: NF8468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8468_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 77 - 240
Target Start/End: Complemental strand, 41785277 - 41785115
Alignment:
| Q |
77 |
atatttctaaattcaatatatcgatcctccaatttaaatgtttattttattcttgtatattttgaggctatatttttgataatataacaattgaaatgtt |
176 |
Q |
| |
|
|||| |||||||| ||||||| | ||||||||||| ||||||||||||| |||||| |||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
41785277 |
atatctctaaatttaatatattggtcctccaatttgaatgtttattttactcttgtgtattttgaggttatatttt-gataatataacaattgagatgtt |
41785179 |
T |
|
| Q |
177 |
tatgtgacaacttaatcgatcacatgacatatttagatgaattttcacttaacttaactttcat |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41785178 |
tatgtgacaacttagtcgatcacatgacatatttagatgaatttttacttaacttagctttcat |
41785115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 41785409 - 41785339
Alignment:
| Q |
17 |
agataggttaaacgtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa |
87 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785409 |
agataggttaaatgtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa |
41785339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University