View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8468_low_10 (Length: 219)
Name: NF8468_low_10
Description: NF8468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8468_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 2497607 - 2497421
Alignment:
| Q |
16 |
agagaaggtattattgtaattgcttaagttttatgttccttagtatgtcaccgtcacctaggggattgggtagttgagctagtttgagataaaggttaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2497607 |
agagaaggtattattgtaattgcttaagttttatgttccttagtatgtcaccgtcacctaggggattgggtagttgagctagtttgagataaaggttaaa |
2497508 |
T |
 |
| Q |
116 |
tgagtcgaaggagttataaaggaccagggtttaaaccctagtgaaggagaaaatcgtaagataacgtgttccttatttgtacatatat |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2497507 |
tgagtcgaaggagttataaaggacca-ggtttaaaccctagtgaaggagaaaatcgtaagataacgtgttccttatttgtatatatat |
2497421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University