View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8468_low_11 (Length: 216)

Name: NF8468_low_11
Description: NF8468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8468_low_11
NF8468_low_11
[»] chr2 (2 HSPs)
chr2 (77-200)||(41785155-41785277)
chr2 (17-87)||(41785339-41785409)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 77 - 200
Target Start/End: Complemental strand, 41785277 - 41785155
Alignment:
77 atatttctaaattcaatatatcgatcctccaatttaaatgtttattttattcttgtatattttgaggctatatttttgataatataacaattgaaatgtt 176  Q
    |||| |||||||| ||||||| | ||||||||||| ||||||||||||| |||||| |||||||||| |||| ||||||||||||||||||||| |||||    
41785277 atatctctaaatttaatatattggtcctccaatttgaatgtttattttactcttgtgtattttgaggttata-ttttgataatataacaattgagatgtt 41785179  T
177 tatgtgacaacttaatcgatcaca 200  Q
    |||||||||||||| |||||||||    
41785178 tatgtgacaacttagtcgatcaca 41785155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 41785409 - 41785339
Alignment:
17 agataggttaaacgtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa 87  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785409 agataggttaaatgtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa 41785339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University