View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8468_low_3 (Length: 361)
Name: NF8468_low_3
Description: NF8468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8468_low_3 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 20 - 172
Target Start/End: Complemental strand, 7729318 - 7729166
Alignment:
| Q |
20 |
tggtagccagaccttaattcaagtttagaaaaatattatgcaccaagcaattcatctaagatttcatccactattggtataggagaactgtctttgatag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
7729318 |
tggtagccagaccttaattcaagtttagaaaaatattatgcaccaagcaattcatctaagatttcatccacaattggaataggaaaactgtctttgatag |
7729219 |
T |
 |
| Q |
120 |
tgatggtgttcaaagccctgtaatccgtgcaaaatctccaagagccatccttc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729218 |
tgatggtgttcaaagccctgtaatccgtgcaaaatctccaagagccatccttc |
7729166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 255 - 352
Target Start/End: Complemental strand, 7729083 - 7728986
Alignment:
| Q |
255 |
ccgagtttagaaatctttgtggtagtgattctcactttgtacaccaaccatcatatctgccgccctaaaccaccagtgaccaccaccttcgtaccacc |
352 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729083 |
ccgagtttagaaatctttgtggtggtgattctcactttgttcaccaaccatcatatctgccgccctaaaccaccagtgaccaccaccttcgtaccacc |
7728986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 168
Target Start/End: Complemental strand, 42809 - 42679
Alignment:
| Q |
38 |
tcaagtttagaaaaatattatgcaccaagcaattcatctaagatttcatccactattggtataggagaactgtctttgatagtgatggtgttcaaagccc |
137 |
Q |
| |
|
||||| ||||||||||| | |||||| | | |||||| || | |||||||||| | || || ||| |||| ||||||| |||||| | |||||| |||| |
|
|
| T |
42809 |
tcaagcttagaaaaatagcaagcaccatgtagttcatccaatagttcatccactgtaggaatgggaaaactatctttgacagtgatagagttcaatgccc |
42710 |
T |
 |
| Q |
138 |
tgtaatccgtgcaaaatctccaagagccatc |
168 |
Q |
| |
|
||||||| || ||||| |||||||| ||||| |
|
|
| T |
42709 |
tgtaatcagtacaaaacctccaagacccatc |
42679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University