View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_high_37 (Length: 241)
Name: NF8469_high_37
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 19807072 - 19807127
Alignment:
| Q |
18 |
gaaacggcccagaccaacgagagcggagctttccagggaataatttcaacctggag |
73 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19807072 |
gaaacggcccagaccaatgagagcggagctttccagggaataatttcaacctggag |
19807127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University