View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_high_41 (Length: 225)
Name: NF8469_high_41
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 1416751 - 1416539
Alignment:
| Q |
1 |
ctatcaaatcatatatatatctcaagatgtat----gcatatttggagtgtataagaaatattttcctaaatgatgattagtgcacatcatgcatgcaca |
96 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416751 |
ctatcaaatcatatatatctctcaagatatatataagcatatttggagtgtataagaaatattttcctaaatgatgattagtgcacatcatgcatgcaca |
1416652 |
T |
 |
| Q |
97 |
caaatttcattaattaaaccgctaggattaagtgaaagaagttgggtgttttgggaacatttatgta--cacataggacaaaggaaaggaaagaggggac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1416651 |
caaatttcattaattaaaccgctaggattaagtgaaagaagttgggtgttttgggaacatttatgtacacacataggacaaaggaaaggaaagaggggac |
1416552 |
T |
 |
| Q |
195 |
cctatagtgtgct |
207 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1416551 |
cctatagtgtgct |
1416539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University