View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_high_46 (Length: 201)
Name: NF8469_high_46
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 186
Target Start/End: Complemental strand, 50505933 - 50505773
Alignment:
| Q |
26 |
agaagattgactaggtacagcatactgtatttcagaattttctttaaaatttaagcatatcaaacctgcttaagcatatcaaaaccgcttaacaactaga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505933 |
agaagattgactaggtacagcatactgtatttcagaattttctttaaaatttaagcatatcaaacctgcttaagcatatcaaaaccgcttaacaactaga |
50505834 |
T |
 |
| Q |
126 |
ctgaaacgcttgccttgattagggactatgagaatttaagagagcgcataactgaatgaag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50505833 |
ctgaaacgcttgccttgattagggactatgagaatttaagagagcgcataactaaatgaag |
50505773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 95 - 186
Target Start/End: Original strand, 28733378 - 28733469
Alignment:
| Q |
95 |
ttaagcatatcaaaaccgcttaacaactagactgaaacgcttgccttgattagggactatgagaatttaagagagcgcataactgaatgaag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
28733378 |
ttaagcatatcaaaaccgcttaacaactagaaagaaatgcttgccttgattaaggactatgagaatttaagagaacacataactaaatgaag |
28733469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University