View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_low_18 (Length: 331)
Name: NF8469_low_18
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 187 - 313
Target Start/End: Original strand, 18590011 - 18590137
Alignment:
| Q |
187 |
tagagtaatactttattttctttttgtttgttgcaaaagagtaacacttgagattttttccgtaaattaatggatttttcctaacgtaaagaaggaaaaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18590011 |
tagagtaatactttattttctttttgtttgttgcaaaagagtaacacttgagattttttccgtaaattaatggatttttcctaatgtaaagaaggaaaaa |
18590110 |
T |
 |
| Q |
287 |
gataatagcccgttgaatgcaataaat |
313 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18590111 |
gataatagcccgttgaatgcaataaat |
18590137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 18589943 - 18589981
Alignment:
| Q |
140 |
aaaatccaaattaaattcatgaattttatatactttact |
178 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
18589943 |
aaaatcctaattaaattgatgaattttatatactttact |
18589981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University