View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_low_20 (Length: 315)
Name: NF8469_low_20
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 35089920 - 35090175
Alignment:
| Q |
17 |
cccgttgcaggggtgagtcatctcctattgcccaatataattgttttttattggaattctcgaggttttggtaacttggacacaacagnnnnnnnnc-ct |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
35089920 |
cccgctgcaggggtgagtcatctcctattgcccaata--attgttttttattggaattcccgaggttttggtaacttggacacaacagttttttttttct |
35090017 |
T |
 |
| Q |
116 |
cataaacatgtggtaannnnnnnnggctgaacctatgattactttggcgcaagttccttctttcaggaccgttgtggtatgcctcactacaagttcccat |
215 |
Q |
| |
|
||||||| |||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35090018 |
cataaacctgtggtaattttttttggccgaacctataattactttggcgcaagttccttctttcaggaccgttgtggtatgcctcactacaagttcccat |
35090117 |
T |
 |
| Q |
216 |
aggctgttggtttttatttccgtctttgtttgtttcttttcgagggttttggtctagt |
273 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35090118 |
aggctgttggtttttattttcgtctttgtttgtttcttttcgagggttttggtctagt |
35090175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University