View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_low_26 (Length: 274)
Name: NF8469_low_26
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 28741996 - 28741746
Alignment:
| Q |
19 |
tttggtacgtgaatctcttcgtattagcggtcgattcatttgcatgtgtcaaaagatgggcatgatt----attcaagctcatctctagtttgtttaatg |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28741996 |
tttggtacgtgaatctattcgtattagcggttgattcatttgcatgtgtcaaaagatgggcatgattgattattcaagctcatctctagtttgtttaatg |
28741897 |
T |
 |
| Q |
115 |
cttgcaacnnnnnnnnnnnnnnnnnnnnngcaatctgatttaagaccctgttttgggttcgttggattgtgtgtgtacctatcttctaggca-ttgggct |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28741896 |
cttgcaactttttacacattttttcttttgcaatctgatttaagaccctgttttgggttcgttggattgtgtgtgtacctatcttctaggcatttgggct |
28741797 |
T |
 |
| Q |
214 |
ctttactagatttttgtcctattttttatataccactcttgttattctctg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28741796 |
ctttactagatttttgtcctattttttatataccacttttgttattctctg |
28741746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University