View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_low_35 (Length: 250)
Name: NF8469_low_35
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_low_35 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 1417056 - 1416813
Alignment:
| Q |
8 |
atggtgttctacaactgaagcaaatttaccaacaatttctttggtttaataattgtaaagcatatagcacttcaaccactttgtattggttcgttaagta |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1417056 |
atggtggtctacaactgaagcaaatttacgaacaatttctttggtttaataattgtaaagcatatagcacttcaaccactttgtattggttcgttaagta |
1416957 |
T |
|
| Q |
108 |
cttccaagtaaaactattaaactttcttccatgaaagtaacaatatcaacacacatgttatgtgatgatcnnnnnnnnnncttcgta---aatggttgcc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||| |||||||| | |
|
|
| T |
1416956 |
cttccaagtaaaactattaaactttcttcaatgaacgtaacaatatcaacacacatgttatgtgatgatcttttttttt--ttcgtaaataatggttgac |
1416859 |
T |
|
| Q |
205 |
aatgtttttctttcccttaattattagttcccttcccttaagtcta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416858 |
aatgtttttctttcccttaattattagttcccttcccttaagtcta |
1416813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University