View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8469_low_41 (Length: 230)
Name: NF8469_low_41
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8469_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 28098983 - 28098769
Alignment:
| Q |
1 |
ttttcaattgtgtttctaaaaaaggtttttctattgtgtgtaaatttgattttnnnnnnngttgatttgtcnnnnnnngtcgtatttggtaaataggaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28098983 |
ttttcaattgtgtttctaaaaaaggtttttctattgtgtgtaaatttgattttaaaaaaagttgatttgtctttttttgtcgtatttggtaaataggaag |
28098884 |
T |
|
| Q |
101 |
taaagaagtttcactcagaatggtctttggccctgggtcctcttaattgcaactatttgccatttttatcattttcacttcttgacttattttgagaccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28098883 |
taaagaagtttcactcagaatggtctttggccctgggtcctcttaattgcaactatttgccatttttatcattttcacttcttgacttattttgagaccc |
28098784 |
T |
|
| Q |
201 |
taaaaactcacttat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28098783 |
taaaaactcacttat |
28098769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University