View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8469_low_44 (Length: 225)

Name: NF8469_low_44
Description: NF8469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8469_low_44
NF8469_low_44
[»] scaffold0189 (1 HSPs)
scaffold0189 (1-210)||(516-725)
[»] scaffold0154 (2 HSPs)
scaffold0154 (1-210)||(24031-24240)
scaffold0154 (1-210)||(14611-14820)


Alignment Details
Target: scaffold0189 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 516 - 725
Alignment:
Q  1 aacaggggaaaaacagagtttgaaatgcaggggaactccactttttatgtcgccggaaacagtaaaccacggtgagcatgaatctccggcggatatttgg 100  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||    
T  516 aacagggggaaaacagagtttgaaatgcaggggaactccactttttatgtcgccggaatcagtaaaccacggtgagcatgaatctccggcggatatatgg 615  T
Q  101 gcacttgggtgtgcagtggtggagatggtaacgggaaaaccagcctggaatttggagaaagattcaaatatgtggtccttgttgcttcggattggtaccg 200  Q
    |||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  616 gcacttgggtgtgcggtggtggagatggtaactggaaaaccagcatggaatttggagaaagattcaaatatgtggtcattgttgcttcggattggtaccg 715  T
Q  201 gagaagaatc 210  Q
    ||||||||||    
T  716 gagaagaatc 725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: scaffold0154
Description:

Target: scaffold0154; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 24240 - 24031
Alignment:
Q  1 aacaggggaaaaacagagtttgaaatgcaggggaactccactttttatgtcgccggaaacagtaaaccacggtgagcatgaatctccggcggatatttgg 100  Q
    |||||||||||||||||||||  ||||||| ||||| || |||||||||||||||||| |||||||| | || |||||||||||||||||||||||||||    
T  24240 aacaggggaaaaacagagttttgaatgcagaggaaccccgctttttatgtcgccggaatcagtaaacaatggcgagcatgaatctccggcggatatttgg 24141  T
Q  101 gcacttgggtgtgcagtggtggagatggtaacgggaaaaccagcctggaatttggagaaagattcaaatatgtggtccttgttgcttcggattggtaccg 200  Q
    |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||| |||    
T  24140 gcacttgggtgtgcagtggtggagatggtaactggaaaaccagcttggaatttggagaaagattcaaatatgtggtcgttgttgcttcagattggtgccg 24041  T
Q  201 gagaagaatc 210  Q
    ||||||||||    
T  24040 gagaagaatc 24031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 14820 - 14611
Alignment:
Q  1 aacaggggaaaaacagagtttgaaatgcaggggaactccactttttatgtcgccggaaacagtaaaccacggtgagcatgaatctccggcggatatttgg 100  Q
    |||||||||||||||||||||  ||||||| ||||| || |||||||||||||||||| |||||||| | || |||||||||||||| ||||||||||||    
T  14820 aacaggggaaaaacagagttttgaatgcagaggaaccccgctttttatgtcgccggaatcagtaaacaatggcgagcatgaatctcccgcggatatttgg 14721  T
Q  101 gcacttgggtgtgcagtggtggagatggtaacgggaaaaccagcctggaatttggagaaagattcaaatatgtggtccttgttgcttcggattggtaccg 200  Q
    |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||| |||    
T  14720 gcacttgggtgtgcagtggtggagatggtaactggaaaaccagcttggaatttggagaaagattcaaatatgtggtcgttgttgcttcagattggtgccg 14621  T
Q  201 gagaagaatc 210  Q
    ||||||||||    
T  14620 gagaagaatc 14611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University