View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8470_high_2 (Length: 501)
Name: NF8470_high_2
Description: NF8470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8470_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 413 - 482
Target Start/End: Complemental strand, 29221791 - 29221722
Alignment:
| Q |
413 |
gatctcactactgtattttagcctcgtaacattttttaaatattagagtgaaagatcgagggaaaatttg |
482 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29221791 |
gatctcactagtgtattttagcctcgtaacattttttaaatattagagtgaaagatcgagggagaatttg |
29221722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 96 - 151
Target Start/End: Complemental strand, 29222095 - 29222040
Alignment:
| Q |
96 |
ccaaattacgtaccttcttcttttgcccctgattttttctgaaatttcactcagtg |
151 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29222095 |
ccaaattacgtaccttcttcctttgcccctgattttttctgaaatttcactcagtg |
29222040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 267 - 304
Target Start/End: Complemental strand, 29221923 - 29221886
Alignment:
| Q |
267 |
gtagcaaacaatgtttgcttggtggacaatcttccgaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29221923 |
gtagcaaacaatgtttgcttggtggacaatcttccgaa |
29221886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University