View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8470_low_7 (Length: 209)
Name: NF8470_low_7
Description: NF8470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8470_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 42334945 - 42334819
Alignment:
| Q |
16 |
atactgctgaatcaaaaaagtaatgtattaaataagataggatctctaatatgcattacaagctaggcatgttggatatccacattctatcttgagggag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334945 |
atactgctgaatcaaaaaagtaatgtattaaataagataggatctctaatatgcattacaagctaggcatgttggatatccacattctatcttgaggga- |
42334847 |
T |
 |
| Q |
116 |
gtggtgttacaacttgttagctgttagtta |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42334846 |
--ggtgttacaacttgttagctgttagtta |
42334819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 136 - 193
Target Start/End: Complemental strand, 42334804 - 42334747
Alignment:
| Q |
136 |
ctgttagttaattagttatatttgacgttgtgtctgtctttattttgttcattattca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334804 |
ctgttagttaattagttatatttgacgttgtgtctgtctttattttgttcattattca |
42334747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 16 - 118
Target Start/End: Complemental strand, 51068177 - 51068072
Alignment:
| Q |
16 |
atactgctgaatcaaaaaagtaatgtattaaataagatagga----tctctaatatgcattacaagctaggcatgttggatatccacattctatcttgag |
111 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||| ||||||||| ||| |
|
|
| T |
51068177 |
atactgctgaat-aaaaaaggaatgtattaaataagatagcaaggctctctaatatgcattacaagcttggcatgttggatatccaaattctatctagag |
51068079 |
T |
 |
| Q |
112 |
ggaggtg |
118 |
Q |
| |
|
||||||| |
|
|
| T |
51068078 |
ggaggtg |
51068072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University