View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8471_high_14 (Length: 218)

Name: NF8471_high_14
Description: NF8471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8471_high_14
NF8471_high_14
[»] chr3 (1 HSPs)
chr3 (79-201)||(39754467-39754589)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 201
Target Start/End: Complemental strand, 39754589 - 39754467
Alignment:
79 gtacttttaccctcccattaacaaggaatatgattcatttgtactttgtagggtggagttcctttctaagtcatcagattttatttaggtttaggggctg 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39754589 gtacttttaccctcccattaacaaggaatatgattcatttgtactttgtagggtggagttcctttctaagtcatcagattttatttaggtttaggggctg 39754490  T
179 tttgctttattaggggaattgat 201  Q
    |||||| ||||||||||||||||    
39754489 tttgctctattaggggaattgat 39754467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University