View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8471_high_7 (Length: 309)
Name: NF8471_high_7
Description: NF8471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8471_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 17276262 - 17275968
Alignment:
| Q |
1 |
gaaaacattatgtaaaagttttggtgttttgttttttccccggctttcgagcacatgatttagtagaagttttgcaacctttcatagaagatgcgtagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
17276262 |
gaaaacattatgtaaaagttttggtgttttgttttttccccggctttcgagcacatgattcagtagaagttttgcaaccttttatagaagatgcagagag |
17276163 |
T |
|
| Q |
101 |
ttttctcactacgcaattaagtcaagattgctcttgtaagggttgatgtacccgttgtactatgataaataaacttttttggttataacaagaaaaacta |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17276162 |
ttttctcactacacaattaagtcaagattgctcttgtaagggttgatgtacccgttgtactatgataaataaacttttttgattataacaagaaaaacta |
17276063 |
T |
|
| Q |
201 |
caaatatcaaaatgagaattccaagnnnnnnnnngtggggtgtgccagacctatgcaatagtgtaacgcatatgcgacacctgataagcccaata |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
17276062 |
caaatatcaaaatgagaattccaagtttttttttttggggtgtgccagacctatgcaatagtgtaacgcatatgtgacaactgataagcccaata |
17275968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 42 - 138
Target Start/End: Complemental strand, 11476841 - 11476745
Alignment:
| Q |
42 |
ggctttcgagcacatgatttagtagaagttttgcaacctttcatagaagatgcgtagagttttctcactacgcaattaagtcaagattgctcttgta |
138 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||| ||||||| ||||||||||||| |||||| ||||||| || | |||||| |||||| |
|
|
| T |
11476841 |
ggcttttgagtacatgatttagtggaagttttgcaaccttttatagaaggtgcgtagagttttttcactatgcaattacgttaggattgcacttgta |
11476745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 31602760 - 31602712
Alignment:
| Q |
45 |
tttcgagcacatgatttagtagaagttttgcaacctttcatagaagatg |
93 |
Q |
| |
|
|||||||| ||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
31602760 |
tttcgagcccatgatttagtggaagctctgcaacctttcatagaagatg |
31602712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University