View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8471_low_11 (Length: 278)
Name: NF8471_low_11
Description: NF8471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8471_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 662292 - 662047
Alignment:
| Q |
19 |
atcgagtttggtgttgtaagttggaagttttaatatgatccaaaactctagacaatttggacgtataagatatacctttaattctttatttcaagcaacg |
118 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
662292 |
atcgagtgtgatgttgtaagttggaagttttaatattatccaaaactctagacaatttggacgtataaattatacctttaattctttatttcaagcaacg |
662193 |
T |
 |
| Q |
119 |
tgagacttattctctgg--cacagagtttagagctattggcatt-aatatcaaatttccagcaacactttcttcatgcattatgtgtttttaacatagag |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
662192 |
tgagacttattctctggcacacagagtttagaactattggcattaaatatcaaatttccagcaacactttcttcatgcattaagtgtttttaacatagag |
662093 |
T |
 |
| Q |
216 |
aaactgccttttttcttgtattgcttgtaacatgctaagacataat |
261 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
662092 |
aaactgccttttttcttatattgcttgtaacatgctaagacataat |
662047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University