View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8471_low_16 (Length: 218)
Name: NF8471_low_16
Description: NF8471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8471_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 201
Target Start/End: Complemental strand, 39754589 - 39754467
Alignment:
| Q |
79 |
gtacttttaccctcccattaacaaggaatatgattcatttgtactttgtagggtggagttcctttctaagtcatcagattttatttaggtttaggggctg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39754589 |
gtacttttaccctcccattaacaaggaatatgattcatttgtactttgtagggtggagttcctttctaagtcatcagattttatttaggtttaggggctg |
39754490 |
T |
 |
| Q |
179 |
tttgctttattaggggaattgat |
201 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
39754489 |
tttgctctattaggggaattgat |
39754467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University