View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8472_low_3 (Length: 384)

Name: NF8472_low_3
Description: NF8472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8472_low_3
NF8472_low_3
[»] chr4 (2 HSPs)
chr4 (218-344)||(17724880-17725006)
chr4 (11-116)||(17724672-17724777)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 218 - 344
Target Start/End: Original strand, 17724880 - 17725006
Alignment:
218 atgtaaaattttggaatgtagtgcaacattctcatgatgcttgataatcaatttttctgtttggatcattgcataattttggtcgacatgaaagaactgt 317  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||| |||||||||    
17724880 atgtaaaattttggaatgtagtgcaacattctcatgatgcttgattgtcaatttttgtgtttggatcattgcataattttggtcgacatggaagaactgt 17724979  T
318 tgaattgatttatgttgattggtgtgg 344  Q
    ||||||||| |||||||||||||||||    
17724980 tgaattgatatatgttgattggtgtgg 17725006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 11 - 116
Target Start/End: Original strand, 17724672 - 17724777
Alignment:
11 gaacctgtgaaactgttgtatataaaaaggatcggttatttcggcggaagatgcgttcgttgattaaggcaaatgcaacgtgttgatggttgcggaaata 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17724672 gaaccggtgaaactgttgtatataaaaaggatcggttatttcggcagaagatgcgttcgttgattaaggcaaatgcaacgtgttgatggttgcggaaata 17724771  T
111 tctaga 116  Q
    ||||||    
17724772 tctaga 17724777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University