View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8473_high_5 (Length: 252)
Name: NF8473_high_5
Description: NF8473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8473_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 24947172 - 24946935
Alignment:
| Q |
13 |
ttattctgtcatcatggaaatcttcagatagaaaaggataatctgtttgattaactatatttgcattggagcagtaaagtgtcgcttgaaattttgtcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24947172 |
ttattctgtcatcatggaaatcttcagatagagaaggataatctgttagattaactatatttgcattggagtagtaaagtgtcacttgaaattttgtcat |
24947073 |
T |
|
| Q |
113 |
gttcgagggtactagttcataattgcagcgatgtgattatagtgttctttttgttcagatcaaataatggtgtttctaagaaagatgtttccttgcgcag |
212 |
Q |
| |
|
||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24947072 |
gtttgagtgtactagttcataattgcagcgatgtgattatagtgttctttttgttcagatcaaataatggtgtttctaagaaagatgtttccttgcacag |
24946973 |
T |
|
| Q |
213 |
atgattttgttcattcaataatgatataggtttacttc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24946972 |
atgattttgttcattcaataatgatataggtttacttc |
24946935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University