View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8473_low_4 (Length: 375)

Name: NF8473_low_4
Description: NF8473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8473_low_4
NF8473_low_4
[»] chr2 (2 HSPs)
chr2 (102-291)||(2263711-2263900)
chr2 (203-253)||(31885825-31885875)
[»] chr4 (7 HSPs)
chr4 (101-291)||(26577927-26578117)
chr4 (143-291)||(10472635-10472784)
chr4 (102-238)||(38245121-38245257)
chr4 (102-164)||(10472784-10472846)
chr4 (341-375)||(26578165-26578199)
chr4 (246-291)||(38245080-38245125)
chr4 (341-375)||(38245000-38245034)
[»] chr1 (7 HSPs)
chr1 (102-291)||(11421756-11421945)
chr1 (102-291)||(34369812-34370000)
chr1 (136-291)||(4097679-4097834)
chr1 (102-291)||(23175258-23175450)
chr1 (341-375)||(34369716-34369750)
chr1 (341-375)||(4097884-4097918)
chr1 (341-375)||(23175498-23175532)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 102 - 291
Target Start/End: Complemental strand, 2263900 - 2263711
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttcctac 201  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||    
T  2263900 tttggttgtttatctttgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgaatttttttttgaaatcggagccatttcctac 2263801  T
Q  202 tactccggctgcggtgccactgccctagggcggccggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    ||||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
T  2263800 tactccggcggcggcgccgctgccctagggcggccggccaccgcaccggaggtgtgtagaagatgaagcttcatcccagatcggtttctt 2263711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 253
Target Start/End: Original strand, 31885825 - 31885875
Alignment:
Q  203 actccggctgcggtgccactgccctagggcggccggccaccgcgccggagg 253  Q
    |||||||| |||| |||||  |||||||||||||||||||| |||||||||    
T  31885825 actccggcggcggcgccaccaccctagggcggccggccaccacgccggagg 31885875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 101 - 291
Target Start/End: Original strand, 26577927 - 26578117
Alignment:
Q  101 atttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttccta 200  Q
    |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
T  26577927 atttggttgtttatctctgaaaaccgagtctgaatttggattatagaaggaaaaggatttttaaaagtgaaaaaaaatttgaaatcggagccatttccta 26578026  T
Q  201 ctactccggctgcggtgccactgccctagggcggccggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    |||||||||| |||  || ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  26578027 ctactccggcggcgccgctactgccctagggcggtcggccaccgcgccggaggtgtgtagaagatgaagcttcatcccagatcggtttctt 26578117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 143 - 291
Target Start/End: Complemental strand, 10472784 - 10472635
Alignment:
Q  143 atagaaggaaaaggatttttaaaagtgnnnnnnnnntt-gaaatcggagccatttcctactactccggctgcggtgccactgccctagggcggccggcca 241  Q
    |||||||||||||||||||||||||||         || |||||||||||||||||||| ||||| ||| |||| ||| ||||||||||| |||||||||    
T  10472784 atagaaggaaaaggatttttaaaagtgatttttttttttgaaatcggagccatttcctaatactctggccgcggcgccgctgccctagggtggccggcca 10472685  T
Q  242 ccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    || ||||||||||||||||||||||||| |||| ||||||||||||||||    
T  10472684 ccacgccggaggtgtgtagaagatgaagcttcagcccagatcggtttctt 10472635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 102 - 238
Target Start/End: Complemental strand, 38245257 - 38245121
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttcctac 201  Q
    ||||||||||||||||||||||||||||||  | ||||||||||||||||||| ||||||||||||||         ||||||||||||||||||||||     
T  38245257 tttggttgtttatctctgaaaaccgagtctgaagttggattatagaaggaaaatgatttttaaaagtgaatttttttttgaaatcggagccatttcctaa 38245158  T
Q  202 tactccggctgcggtgccactgccctagggcggccgg 238  Q
    ||||||||| |||   || ||||||||||||||||||    
T  38245157 tactccggcggcgccaccgctgccctagggcggccgg 38245121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 10472846 - 10472784
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaa 164  Q
    ||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||    
T  10472846 tttggttgtttatctctgaaaactgagtccggatttggattatagaaggaaaaggatttttaa 10472784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 375
Target Start/End: Original strand, 26578165 - 26578199
Alignment:
Q  341 aatgacaaacacaaaatgaaagaaatctgatggtt 375  Q
    |||||||||||||||||||||||||||||||||||    
T  26578165 aatgacaaacacaaaatgaaagaaatctgatggtt 26578199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 246 - 291
Target Start/End: Complemental strand, 38245125 - 38245080
Alignment:
Q  246 gccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    |||||||||||||||||||||||  ||||||||||||| |||||||    
T  38245125 gccggaggtgtgtagaagatgaaacttcatcccagatcagtttctt 38245080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 375
Target Start/End: Complemental strand, 38245034 - 38245000
Alignment:
Q  341 aatgacaaacacaaaatgaaagaaatctgatggtt 375  Q
    ||||||||||||||||| |||||||||||||||||    
T  38245034 aatgacaaacacaaaataaaagaaatctgatggtt 38245000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 102 - 291
Target Start/End: Complemental strand, 11421945 - 11421756
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttcctac 201  Q
    |||||||||||||||||||||| ||||||  |||||||||||||||||||||||||||||||||| ||         |||||||||||||||||||||||    
T  11421945 tttggttgtttatctctgaaaatcgagtccggatttggattatagaaggaaaaggatttttaaaattgattttttttttgaaatcggagccatttcctac 11421846  T
Q  202 tactccggctgcggtgccactgccctagggcggccggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    ||||||||| |||| ||| ||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||    
T  11421845 tactccggcggcggcgccgctgccctagggtggccggccaccgcgccagaggtgtgtagaagatgaagcttcatcccagatcgatttctt 11421756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 102 - 291
Target Start/End: Complemental strand, 34370000 - 34369812
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttcctac 201  Q
    ||||||||||||||||||||||||||||||  ||||||||||||||| ||||||||||||||||||||         | ||||| |||||||||||||||    
T  34370000 tttggttgtttatctctgaaaaccgagtctgaatttggattatagaacgaaaaggatttttaaaagtgattttttt-tggaaattggagccatttcctac 34369902  T
Q  202 tactccggctgcggtgccactgccctagggcggccggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    |||||| || |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
T  34369901 tactccagcggcggcgccgctgccctagggcggccggccaccgcaccggaggtgtgtagaagatgaagcttcatcccagatcggtttctt 34369812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 136 - 291
Target Start/End: Original strand, 4097679 - 4097834
Alignment:
Q  136 ttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnnttgaaatcggagccatttcctactactccggctgcggtgccactgccctagggcggc 235  Q
    ||||| ||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||| | || ||| |||||||||||||||    
T  4097679 ttggaatatagaaggaaaaggatttttaaaagtgaaaaaaaagttgaaatcggagccatttcctactactccggcggtggcgccgctgccctagggcggc 4097778  T
Q  236 cggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
T  4097779 cggccaccgcgccggagctgtgtagaagatgaagcttcatcccagatcggtttctt 4097834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 102 - 291
Target Start/End: Original strand, 23175258 - 23175450
Alignment:
Q  102 tttggttgtttatctctgaaaaccgagtctagatttggattatagaaggaaaaggatttttaaaagtgnnnnnnnnntt---gaaatcggagccatttcc 198  Q
    ||||||||||||||| |||||||||||||  ||||||||||||||||||||||||| |||||||||||         ||   ||||||||||||||||||    
T  23175258 tttggttgtttatctttgaaaaccgagtccggatttggattatagaaggaaaaggaattttaaaagtgaattttttttttttgaaatcggagccatttcc 23175357  T
Q  199 tactactccggctgcggtgccactgccctagggcggccggccaccgcgccggaggtgtgtagaagatgaagtttcatcccagatcggtttctt 291  Q
    |||||||| ||| || | |||  |||||||||||||||||||||||||||| ||||||||| ||||||||| |||||||||||| ||||||||    
T  23175358 tactactctggcggccgcgccgatgccctagggcggccggccaccgcgccgaaggtgtgtaaaagatgaagcttcatcccagattggtttctt 23175450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 375
Target Start/End: Complemental strand, 34369750 - 34369716
Alignment:
Q  341 aatgacaaacacaaaatgaaagaaatctgatggtt 375  Q
    |||||||||||||||||||||||||||||||||||    
T  34369750 aatgacaaacacaaaatgaaagaaatctgatggtt 34369716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 375
Target Start/End: Original strand, 4097884 - 4097918
Alignment:
Q  341 aatgacaaacacaaaatgaaagaaatctgatggtt 375  Q
    |||||||||||||||||||||||||| ||||||||    
T  4097884 aatgacaaacacaaaatgaaagaaatttgatggtt 4097918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 375
Target Start/End: Original strand, 23175498 - 23175532
Alignment:
Q  341 aatgacaaacacaaaatgaaagaaatctgatggtt 375  Q
    |||||||||||||||||||||||||| ||||||||    
T  23175498 aatgacaaacacaaaatgaaagaaatttgatggtt 23175532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University