View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8474_high_2 (Length: 259)
Name: NF8474_high_2
Description: NF8474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8474_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 1597414 - 1597639
Alignment:
| Q |
20 |
ggttggttgagcatcggcctcgtccatctaatcctgaccatgtcgatagggtaaccttctttctcccctttgcaccgcttagtatcatccaatcatatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1597414 |
ggttggttgagcatcggcctcgtccatctaatcctgaccatgtcgatagggtaaccttctttctcccctttgcaccgcttagtatcatccaatcatatca |
1597513 |
T |
|
| Q |
120 |
tgcacatatatatagtttgtgtttgttgggcacagacaatgcgacaattgtgtaggattgctgggttgaatgtgttttgagaccattctatcaattaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1597514 |
tgcacatatatatagtttgtgtttgttgggcacagacaatgcgacaattgtgtaggattgctgagttgaatgtgttttgagaccattctatcaattaatt |
1597613 |
T |
|
| Q |
220 |
ttgaatcttatttattttcttctagt |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1597614 |
ttgaatcttatttattttcttctagt |
1597639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University