View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8475_high_1 (Length: 207)
Name: NF8475_high_1
Description: NF8475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8475_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 111 - 192
Target Start/End: Complemental strand, 19821817 - 19821736
Alignment:
| Q |
111 |
gatgagaaatactacttatgattcaaaagtggggagtaaaagatttgttagagtctgaagtgtcgaaagatccatcaatatt |
192 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19821817 |
gatgagaaatactacctatgattcaaaagtggggagtaaaagatttgttagagtctggagtgtcgaaagatccatcaatatt |
19821736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 31 - 92
Target Start/End: Original strand, 19821903 - 19821964
Alignment:
| Q |
31 |
gaaaaatacttatctttgttgttgtaatccatttatgtggcagcacagcaacaacaaaacag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19821903 |
gaaaaatacttatctttgttgttgtaatccatttatgtggcagcacagcaacaacaaaacag |
19821964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 14 - 70
Target Start/End: Complemental strand, 19822031 - 19821975
Alignment:
| Q |
14 |
agagagaaaagggggaagaaaaatacttatctttgttgttgtaatccatttatgtgg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822031 |
agagagaaaagggggaagaaaaatacttatctttgttgttgtaatccatttatgtgg |
19821975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 55
Target Start/End: Complemental strand, 19897228 - 19897187
Alignment:
| Q |
14 |
agagagaaaagggggaagaaaaatacttatctttgttgttgt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
19897228 |
agagagaaaagggggaagaaaaatacttgtctttgttattgt |
19897187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University