View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8475_low_2 (Length: 229)
Name: NF8475_low_2
Description: NF8475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8475_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 31155014 - 31155215
Alignment:
| Q |
14 |
cagagatgcaccccgacaaacgtattagtgaatcagaaagcttctcacctttcttgcaattgtgatcttgcaaaaatcgatcaactttgtccgcgtgttg |
113 |
Q |
| |
|
||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31155014 |
cagagatgctccccgacgaacatattagtgaatcagaaagcttctcacctttcttgcaattgtgatcttgcaaaaatcgatcaactttgtccgcgtgttg |
31155113 |
T |
 |
| Q |
114 |
acaattgatcattgaagaggaggcttgaacacttgatcgattatttggtttcttgctggcttcggaaatcacaaactgagtttcttcatctttgtttctt |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31155114 |
acacttgatcattgaagaggaggcttgaacacttgattgattatttggtttcttgctggcttcggaaatcacaaactgagtttcttcatctttctttctt |
31155213 |
T |
 |
| Q |
214 |
ct |
215 |
Q |
| |
|
|| |
|
|
| T |
31155214 |
ct |
31155215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University