View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8476_high_5 (Length: 272)
Name: NF8476_high_5
Description: NF8476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8476_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 109 - 241
Target Start/End: Complemental strand, 36362117 - 36361985
Alignment:
| Q |
109 |
atttggagagttacactcgagcttgtaatcactttgttgaagagataataatgaagttggaatatggcaagtagggtttctcctcttccatgttgggatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36362117 |
atttggagagttacactcgagcttgtaatcactttgttgaagagataataatgaagttggaatatggcaagtagggtttcttctcttccatgttgagatg |
36362018 |
T |
 |
| Q |
209 |
ttatgagtcaatctattttcttgatccattgag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36362017 |
ttatgagtcaatctattttcttgatccattgag |
36361985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 36362212 - 36362153
Alignment:
| Q |
14 |
cccgtaatttcttctaccctagcagtaccattctctttattctcttcctctttggccttt |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362212 |
cccgtaatttcttctaccctagcagtaccattctctttattctcttcctctttggccttt |
36362153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University