View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_25 (Length: 335)
Name: NF8477_high_25
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 25 - 164
Target Start/End: Original strand, 55170134 - 55170273
Alignment:
| Q |
25 |
gtaacattattatgttgtcattgacaaacaccaactttagatacgtacagatctatatcaacctgtctcacagttatacttactaccttttccttttgtt |
124 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170134 |
gtaacattattgttttgtcattgacaaacaccaactttagatacgtacagatctatatcaacctgtctcacagttatacttactaccttttccttttgtt |
55170233 |
T |
 |
| Q |
125 |
tcctaatttctaattctaattatgaccgattgtctgttaa |
164 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55170234 |
tcctaatttctaattctaattatgacagattgtctgttaa |
55170273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 172 - 328
Target Start/End: Original strand, 55170346 - 55170506
Alignment:
| Q |
172 |
aatggtccttacaaacaaatattcataattttggatagtatttt--ttaagtacaaaaaggttacaactgtgacaatctatgattgccgtgtttacat-- |
267 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55170346 |
aatggtccttacaaacaaatattcagaattttggatagtattttttttaagtacaaaaaggttacaactgggacaatctatgattgccgtgtttacattg |
55170445 |
T |
 |
| Q |
268 |
tgattcgaatccagnnnnnnncttcttatgcacttgattttctttcatttcagaataatat |
328 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170446 |
tgattcgaatccagtttttttcttcttatgcacttgattttctttcatttcagaataatat |
55170506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University