View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_27 (Length: 324)
Name: NF8477_high_27
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 20 - 311
Target Start/End: Complemental strand, 47170432 - 47170141
Alignment:
| Q |
20 |
cataggcatgcatgtaacattatcccatgattataaatgatataaattaggttaggtttattacggaagagacatgggaatgggaaaacatacgacgagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170432 |
cataggcatgcatgtaacattatcccatgattataaatgatataaattaggttaggtttattacggaagagacatgggaatgggaaaacatacgacgagt |
47170333 |
T |
|
| Q |
120 |
tcgacgacgtcgagggcggaagcattggatcggagagcagagataccgagattgagacattcggtaagaagctgtttggcttcttgctgacggtgtggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170332 |
tcgacgacgtcgagggcggaagcattggatcggagagcagagataccgagattgagacattcggtaagaagctgtttggcttcttgctgacggtgtggtg |
47170233 |
T |
|
| Q |
220 |
gcaggttaggatccacacctgcgccgccatgaacagcaatagcccaaccagacatgnnnnnnnctctcttgttttaaccttattttctctct |
311 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47170232 |
ggaggttaggatccacacctgcaccgccatgaacagcaatagcccaaccagacatgtttttttctctcttgttttaaccttattttctctct |
47170141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 96 - 269
Target Start/End: Original strand, 42165560 - 42165733
Alignment:
| Q |
96 |
ggaatgggaaaacatacgacgagttcgacgacgtcgagggcggaagcattggatcggagagcagagataccgagattgagacattcggtaagaagctgtt |
195 |
Q |
| |
|
|||||| |||||||||| || ||||| ||||| |||| || ||| ||||||| ||||||||| | || || | ||| ||||| | |||||||| |||| |
|
|
| T |
42165560 |
ggaatgagaaaacatacaacaagttcaacgacatcgacagcagaaccattggaacggagagcaaatatgccaatattaagacaatgagtaagaagttgtt |
42165659 |
T |
|
| Q |
196 |
tggcttcttgctgacggtgtggtggcaggttaggatccacacctgcgccgccatgaacagcaatagcccaacca |
269 |
Q |
| |
|
||||||||| |||||| |||||||| || |||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
42165660 |
tggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatgcacagcaatagcccaacca |
42165733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University