View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_34 (Length: 301)
Name: NF8477_high_34
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_34 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 301
Target Start/End: Complemental strand, 43383787 - 43383491
Alignment:
| Q |
17 |
aatcatctcattattattaaccgcttccccttccac------gtttccaccacgagtcattgtgtcatcgtgaggcgtcatgaatgtccttccagtagta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43383787 |
aatcatctcattattattaaccgcttccccttccacttccacgtttccaccacgagtcattgtgtcatcgtgaggcgtcatgaacgtccttccagtagta |
43383688 |
T |
 |
| Q |
111 |
gaattagaagaagcggttattgttgt------attggcgaaacagcccttgacattcttgtgactagccctatgtcctccaagtgcctgatgggatccaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43383687 |
gaattagaagaagcggttattgttgttgttgtattggcgaaacagcccttgacattcttgtgactagccctgtgtcctccaagtgcctgatgggatccaa |
43383588 |
T |
 |
| Q |
205 |
atactttgttacaacatgaacacacaaactgatcattctcatcgaccatcaccgttgttgttgattttgc---tgctttcttgttctttggatttgaatt |
301 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
43383587 |
atactttgttacaacacgaacacacaaactgatcatcctcatcgac---caccgttgttgttgcttttgcttttgctttcttgttctttggatttgaatt |
43383491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 140 - 267
Target Start/End: Complemental strand, 25870382 - 25870258
Alignment:
| Q |
140 |
ggcgaaacagcccttgacattcttgtgactagccctatgtcctccaagtgcctgatgggatccaaatactttgttacaacatgaacacacaaactgatca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
25870382 |
ggcgaaacagcccttgacattcttgtgactagccctgtgtcctccaagtgcctgatgggatccaaatactttgttgcaacacgaacacacaaactgatc- |
25870284 |
T |
 |
| Q |
240 |
ttctcatcgaccatcaccgttgttgttg |
267 |
Q |
| |
|
|||||| ||| |||||||||||||| |
|
|
| T |
25870283 |
--ctcatcatccaccaccgttgttgttg |
25870258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University