View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_45 (Length: 240)
Name: NF8477_high_45
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 45 - 190
Target Start/End: Complemental strand, 7751447 - 7751299
Alignment:
| Q |
45 |
tcatgtgccctcccgccgcctcataaccagtccacttgtgcttcaaatcatcaacttgattaataatgccagcattatacatttaaatcatactctata- |
143 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7751447 |
tcatgtgccctcccgctgcctcataaccagtccacttgtgcttcaaatcatcaacttgatcaataatgccagcattatacatttaaatcattctctataa |
7751348 |
T |
 |
| Q |
144 |
--aatagtaactatgttcccaacttttcttgcatcttctcatcaaacac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7751347 |
ataatagtaactatgttcccaacttttcttgcatcttctcatcaaacac |
7751299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 7751283 - 7751251
Alignment:
| Q |
203 |
ttaaattccaatcatgcaatcttcaacaccaaa |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
7751283 |
ttaaattccaatcatgcaatcttcatcaccaaa |
7751251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University