View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_48 (Length: 238)
Name: NF8477_high_48
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 49 - 214
Target Start/End: Original strand, 10194065 - 10194225
Alignment:
| Q |
49 |
atcttttcagtaatagaattcaatttactttactgtcatgatatgtgttctataaccttataccagtagtacataatctggtattgcaatttgtcataaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10194065 |
atcttttcagtaatagaattcaatttactttactgtcatgatatgtgttctataaccttataccagtagtacataatctggtattgcaatttgtcataaa |
10194164 |
T |
 |
| Q |
149 |
ctgcatcgcatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccat |
214 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10194165 |
ct-----gaatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccat |
10194225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University