View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_high_54 (Length: 201)
Name: NF8477_high_54
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_high_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 168
Target Start/End: Original strand, 2101494 - 2101645
Alignment:
| Q |
17 |
cagagaggtgaatcgttcatcttcttcatttatgaatgattaggatctgtttggcaaaccgaaaatttggattatgtttcataagcttttaaaaaagttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2101494 |
cagagaggtgaatcgttcatcttcttcatttatgaatgattaggatctgtttggcaaaccgcaaatttggattatgtttcataagcttttaaaaaagttt |
2101593 |
T |
 |
| Q |
117 |
tgttttgtaattttcacgttttcatgagcttatagtttatatttaccggctt |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
2101594 |
tgttttgtaattttcacgttttcacgagcttatagtttatatttacaggctt |
2101645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 99; Significance: 4e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 46 - 168
Target Start/End: Complemental strand, 39185054 - 39184932
Alignment:
| Q |
46 |
ttatgaatgattaggatctgtttggcaaaccgaaaatttggattatgtttcataagcttttaaaaaagttttgttttgtaattttcacgttttcatgagc |
145 |
Q |
| |
|
|||| |||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
39185054 |
ttatcaatggttaggatctgtttggcaaaccgcaaatttggattatgttttataagcttttaaaagagttttgttttgtaattttcacgttttcaagagc |
39184955 |
T |
 |
| Q |
146 |
ttatagtttatatttaccggctt |
168 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39184954 |
ttatagtttatatttaccggctt |
39184932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University