View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_low_17 (Length: 387)
Name: NF8477_low_17
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 7751282 - 7750906
Alignment:
| Q |
1 |
taaattccaatcatgcaatcttcatcaccaaaatcccatgttctctctttcatattcacattgtttatttgtctctcttatttgaacctctctatatctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7751282 |
taaattccaatcatgcaatcttcatcaccaaaatcccatgttctctctttcatattcacattgtttatttgtctctcttatttgaacctctttatatctg |
7751183 |
T |
|
| Q |
101 |
ctcaagcatgcaaccacaacgacaaaaatgttctcctagagatcaaatcccattttggaaacaatgcttccgtctttaccacctgggatcctaacacgaa |
200 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7751182 |
ctcaagcatgcaaccataatgacaaaaatgttctcctagagatcaaatcccatttcggaaacaatgcttccgtctttaccacgtgggatcctaacacgaa |
7751083 |
T |
|
| Q |
201 |
ctgctgccagaactggacaggcatcacgtgtgacacgaatggccgtgtcaattcgcttgtagtcattaatgcggatgacatcaacaacgaattcccatcc |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7751082 |
ctgctgccagaactggacaggcatcgcgtgtgacacgaatggtcgtgtcaattcgcttatagtcattaatgcggatgacatcaacaacgaatttccatcc |
7750983 |
T |
|
| Q |
301 |
tcggtaggaaatctcccatttcttcaagttctccaattctccgctttaccccatgtgtctggtgaaatcccttcatc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750982 |
tcggtaggaaatctcccatttcttcaagttctccaattctccgctttaccccatgtgtctggtgaaatcccttcatc |
7750906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University