View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_low_37 (Length: 297)
Name: NF8477_low_37
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 21459118 - 21458915
Alignment:
| Q |
16 |
aactagttctaccagacttaattattccggaaggtgcggcctctcgccactgaagtgtttaattttcatttcatattgttgcatgttggttagaagcttc |
115 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21459118 |
aactagtactaccagactttattattccggaaggtgcggtctctcgccactgaagtgtttaattttcatttcatattgttgcatgttggttagaagctta |
21459019 |
T |
|
| Q |
116 |
tcttagtgagttatttatttcctactatagataatatggaaaatgaggaatattcatttactgtgcactatatgaaaatcaaatcatcaaaatataattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| | |||||| |
|
|
| T |
21459018 |
tcttagtgagttatttatttcctactatagataatatggaaaatgaggaatattcatttactgtgcactatatg-aaatcaaaccatcaaagtgtaattg |
21458920 |
T |
|
| Q |
216 |
gatta |
220 |
Q |
| |
|
||||| |
|
|
| T |
21458919 |
gatta |
21458915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University