View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8477_low_48 (Length: 240)

Name: NF8477_low_48
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8477_low_48
NF8477_low_48
[»] chr7 (2 HSPs)
chr7 (45-190)||(7751299-7751447)
chr7 (203-235)||(7751251-7751283)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 45 - 190
Target Start/End: Complemental strand, 7751447 - 7751299
Alignment:
45 tcatgtgccctcccgccgcctcataaccagtccacttgtgcttcaaatcatcaacttgattaataatgccagcattatacatttaaatcatactctata- 143  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||     
7751447 tcatgtgccctcccgctgcctcataaccagtccacttgtgcttcaaatcatcaacttgatcaataatgccagcattatacatttaaatcattctctataa 7751348  T
144 --aatagtaactatgttcccaacttttcttgcatcttctcatcaaacac 190  Q
      |||||||||||||||||||||||||||||||||||||||||||||||    
7751347 ataatagtaactatgttcccaacttttcttgcatcttctcatcaaacac 7751299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 7751283 - 7751251
Alignment:
203 ttaaattccaatcatgcaatcttcaacaccaaa 235  Q
    ||||||||||||||||||||||||| |||||||    
7751283 ttaaattccaatcatgcaatcttcatcaccaaa 7751251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University