View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_low_54 (Length: 221)
Name: NF8477_low_54
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 37 - 207
Target Start/End: Complemental strand, 31843336 - 31843167
Alignment:
| Q |
37 |
gacaagaacttaaattcttctttctatattttgannnnnnnnnaatattaaaagaatatgcctctccagtaccaataaagaaaggctctgtcttcagcta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31843336 |
gacaagaacttaaattcttctttctatattttgatttttttt-aatattaaaagaatatgcctctccagtaccaataaagaaaggctctgtcttcagcta |
31843238 |
T |
 |
| Q |
137 |
ttttgaattgcataattcgtattaggcatttgtacttgtggagtgagtactttatacctatatgatagtgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31843237 |
ttttgaattgcataattcgtattaggcatttgtacttgtggagtgagtactttatacctatatgatagtgg |
31843167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University