View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8477_low_56 (Length: 215)
Name: NF8477_low_56
Description: NF8477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8477_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 3017777 - 3017594
Alignment:
| Q |
18 |
gtaacaagaaaaataaatccttacaacatgttaagactgaaaacaggtcaccgtgttagaccaccaaaaatgaattatatcacatgtagttcagtttaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3017777 |
gtaacaagaaaaataaatccttacaacatgttaagactgaaaacaggtcaccgtgttagactacaaaaaatg-attatatcacatgtagttcagtttaat |
3017679 |
T |
 |
| Q |
118 |
ttaaatgactttttnnnnnnnttagctaataattttattgatttttgaatatccagattggaatttgtaatttttccttcaacac |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3017678 |
ttaaatgacttattaaaaaaattagctaataattttattgatttttgaatatccagattggaatttgtaatttttccttcaacac |
3017594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University