View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_18 (Length: 362)
Name: NF8478_high_18
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 201 - 356
Target Start/End: Original strand, 34283626 - 34283781
Alignment:
| Q |
201 |
tagaacatttgtgatgtctatgatcctttgactaggtggaattgaatgtcattttatgtgtgagttgtaaattatggtattccatttattttaattttta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34283626 |
tagaacatttgtgatgtctatgatcctttgactaggtggaattgaatgtcattttatatgtgagttgtaaattatggtattccgtttattttaattttta |
34283725 |
T |
 |
| Q |
301 |
ttgactcgacatatgatggacattgagaaactaatataatgctaccttcttctcac |
356 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
34283726 |
ttgactcaacatatgatggacattgagaaattaatataatgctaccttcctctcac |
34283781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 34283284 - 34283344
Alignment:
| Q |
141 |
aaacatactaggaaaaaagacggggcgtctttttgctctttttattgcctctatattaacta |
202 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
34283284 |
aaacatactagggaaaa-gacgggcggtctttttactctttttattgcttctatattaacta |
34283344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University