View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_20 (Length: 317)
Name: NF8478_high_20
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_20 |
 | |
|
| [»] scaffold0164 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 43558224 - 43558058
Alignment:
| Q |
18 |
caagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagtactcaatcatatatcaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43558224 |
caagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagtactcaatcatatatcaaatg |
43558125 |
T |
|
| Q |
118 |
atcctaaggtttgatatttcatttatatta----attattcataggtatctctatgtcacaacctat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43558124 |
atcctaaggtttgatatttcatttatattaattaattattcatagatatctctatgtcacaacctat |
43558058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 246 - 314
Target Start/End: Complemental strand, 43558045 - 43557977
Alignment:
| Q |
246 |
ataatctcaaacaacaggcagaaatcttggaaccagcggtccaaggtacgctgaatgttttgcgttctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43558045 |
ataatctcaaacaacaggcagaaatcttggaaccagcagtccaaggtacgctgaatgttttgcgttctt |
43557977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 23674 - 23458
Alignment:
| Q |
18 |
caagctgatttaatggaagaaaatagcttcgacaatgcgatcatgggatgcaaaggtgtctttcacattgcctctccagtactcaatcatatatcaaatg |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23674 |
caagctgatttaatggaacaaaatagcttcgacaaagcgatcatgggatgcaaagctgtctttcacattgcctctccagtacccaatcatatatcaaatg |
23575 |
T |
|
| Q |
118 |
atcctaaggtttgatatttcatttatattaattattcataggtatctctatgtcacaacctataagcttgcttatacattaatcaaaatcttcacatcat |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||| |||||| ||||||||| |
|
|
| T |
23574 |
gtcctaaggtgtgatatttcatttatatta----ttcataggtatctctatgtcacaacctataagctc----atgcattaattaaaatcctcacatcat |
23483 |
T |
|
| Q |
218 |
ggagactatacacatagtgaaataagt |
244 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
23482 |
ggagactat--acatagtgaaataagt |
23458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 259 - 314
Target Start/End: Complemental strand, 23407 - 23352
Alignment:
| Q |
259 |
acaggcagaaatcttggaaccagcggtccaaggtacgctgaatgttttgcgttctt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23407 |
acaggcagaaatcttggaaccagcggtccaaggtacgctaaatgtgttgcgttctt |
23352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University