View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_21 (Length: 314)
Name: NF8478_high_21
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 43819255 - 43818933
Alignment:
| Q |
1 |
ggtttccatcatgagaaattgagaatgctgccacaaaattgtatcctctttccctgttaaagggatatatatcttgtccagaattctcgtaa-------- |
92 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43819255 |
ggtttccatcatgagaaattgagaatgttgccacaaaattgtatcctctttccctgttaaagggatatatatcttgtccagaattctcgtaaagaggggt |
43819156 |
T |
 |
| Q |
93 |
---gcttggagatacaccgagggatactccactttgcattgagaatgaaaactcacactagattgtagaacatggtgcagatattcaggtatactaatta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43819155 |
aaagcttggagatacaccgagggatactccactttgcattgagaatgaaaactcacactagattgtagaacatggtgcagatattcaggtatactaatta |
43819056 |
T |
 |
| Q |
190 |
agggcgtgaattaggggttcttttcgccacttataagaccataaattgatgttgacaccactcgcaatttcccaataaacattgtgcattacctccgagt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43819055 |
agggcgtgaattaggggttcttttcgccacttataagaccataaattgatgttgacaccactcgcaatttcccaataaacattgtgcattacctccgagt |
43818956 |
T |
 |
| Q |
290 |
acttttgcttctctgctactcca |
312 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
43818955 |
acttttgcttttctgctactcca |
43818933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University