View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_29 (Length: 242)
Name: NF8478_high_29
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 38563399 - 38563617
Alignment:
| Q |
19 |
aattgtccattcatttgaatttcagctttaaaccagcaaagacgacaaataaacaattaatatgataatgatatttgctagcttccaaatttcaatacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38563399 |
aattgtccattcatttgaatttcagctttaaaccagcaaagacgacaaataaacaattaatatgataatgatatttgctagcttccaaatttcaatgcgt |
38563498 |
T |
 |
| Q |
119 |
aggatggatctgagttataagatggcgtgcacatcctcatccactagtctactagtatgctagagtactctaacctttcaatacaagaagcaagattcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38563499 |
aggatggatctgagttataagatggcgtgcacatcctcatcca-----ctactagtatgctagagtactctaacctttcaatacaagaagcaagattcaa |
38563593 |
T |
 |
| Q |
219 |
atgctgtaaaagaccagtcaaaac |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38563594 |
atgctgtaaaagaccagtcaaaac |
38563617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University