View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_34 (Length: 228)
Name: NF8478_high_34
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 52723764 - 52723660
Alignment:
| Q |
118 |
ttttgtaattcgaagatcatttgaattattattatgtttcataatttatttataaaaatttcaatcatacataaaacaaaa-aacaccaaatttagtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||| ||||| | || ||||||| |||| |||||||||||||||||| |
|
|
| T |
52723764 |
ttttgtaattcgaagatcatttgaa-tattattatgtttcatagtttgtttataagaattttgagaatgcataaaataaaagaacaccaaatttagtttt |
52723666 |
T |
|
| Q |
217 |
gcataa |
222 |
Q |
| |
|
||||| |
|
|
| T |
52723665 |
tcataa |
52723660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 228
Target Start/End: Complemental strand, 52714658 - 52714623
Alignment:
| Q |
193 |
acaaaaaacaccaaatttagttttgcataaaagatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52714658 |
acaaaaaacaccaaatttagttttgcataaaagatt |
52714623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 6649333 - 6649289
Alignment:
| Q |
58 |
tcaaaagtttgaaccccc-gacccaggatcctgacaacgccactg |
101 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
6649333 |
tcaaaagtttgaaccccctgacctaggatcctgactacgccactg |
6649289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University