View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_high_38 (Length: 212)
Name: NF8478_high_38
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 76 - 194
Target Start/End: Complemental strand, 33615288 - 33615170
Alignment:
| Q |
76 |
cagggtaccaagattcatgccagtgttaggaagcaacttctttatgttttccaaagcaagttgaatgaggggaaggtttatcagatgtcatgtttctatg |
175 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| || |
|
|
| T |
33615288 |
cagggtaccaagatccatgccggtgtgaggaagcagcttctttatgttttccaaagcaagttgagcgagggaaaggtttatcagatgtcatgtttctctg |
33615189 |
T |
|
| Q |
176 |
ttgctccaagtgttggttc |
194 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33615188 |
ttgctccaagtgttggttc |
33615170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 76 - 194
Target Start/End: Original strand, 33436408 - 33436526
Alignment:
| Q |
76 |
cagggtaccaagattcatgccagtgttaggaagcaacttctttatgttttccaaagcaagttgaatgaggggaaggtttatcagatgtcatgtttctatg |
175 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||| ||||| ||| ||||||| ||||||| || |
|
|
| T |
33436408 |
cagggtaccaagatccatgccagtgtgaggaagcaacttttttatgttttccaaagcaagttgagcgagggaaaggtctatgagatgtcctgtttctctg |
33436507 |
T |
|
| Q |
176 |
ttgctccaagtgttggttc |
194 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33436508 |
ttgctccaagtgttggttc |
33436526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University