View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8478_low_38 (Length: 228)

Name: NF8478_low_38
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8478_low_38
NF8478_low_38
[»] chr3 (2 HSPs)
chr3 (118-222)||(52723660-52723764)
chr3 (193-228)||(52714623-52714658)
[»] chr8 (1 HSPs)
chr8 (58-101)||(6649289-6649333)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 52723764 - 52723660
Alignment:
118 ttttgtaattcgaagatcatttgaattattattatgtttcataatttatttataaaaatttcaatcatacataaaacaaaa-aacaccaaatttagtttt 216  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||| |||||  |  || ||||||| |||| ||||||||||||||||||    
52723764 ttttgtaattcgaagatcatttgaa-tattattatgtttcatagtttgtttataagaattttgagaatgcataaaataaaagaacaccaaatttagtttt 52723666  T
217 gcataa 222  Q
     |||||    
52723665 tcataa 52723660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 228
Target Start/End: Complemental strand, 52714658 - 52714623
Alignment:
193 acaaaaaacaccaaatttagttttgcataaaagatt 228  Q
    ||||||||||||||||||||||||||||||||||||    
52714658 acaaaaaacaccaaatttagttttgcataaaagatt 52714623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 6649333 - 6649289
Alignment:
58 tcaaaagtttgaaccccc-gacccaggatcctgacaacgccactg 101  Q
    |||||||||||||||||| |||| ||||||||||| |||||||||    
6649333 tcaaaagtttgaaccccctgacctaggatcctgactacgccactg 6649289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University