View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8478_low_39 (Length: 228)
Name: NF8478_low_39
Description: NF8478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8478_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 99 - 223
Target Start/End: Original strand, 34190888 - 34191012
Alignment:
| Q |
99 |
ctgtgttcacattggattaatcttcaaaattcgaatcaagcaatacggtagaatcggttaaactataaactaaagttatctatagtttagttatttggtc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190888 |
ctgtgttcacattggattaatcttcaaaattcgaatcaagcaatacggtagaatcggttaaactataaactaaagttatctatagtttagttatttggtc |
34190987 |
T |
|
| Q |
199 |
gtttcatcataatcatgtccaatat |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34190988 |
gtttcatcataatcatgtccaatat |
34191012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 34190790 - 34190855
Alignment:
| Q |
1 |
ccggtttttagttgcaaatttagtgctgatcgaaattctagatcaaggtgagtttggttaatcttg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190790 |
ccggtttttagttgcaaatttagtgctgatcgaaattctagatcaaggtgagtttggttaatcttg |
34190855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University